ATAC-seq GTM with control and macs2


StepAnnotation
Step 1: Input dataset collection
select at runtime
Step 2: Input dataset collection
select at runtime
Step 3: Input dataset collection
select at runtime
Step 4: Input dataset collection
select at runtime
Step 5: Input dataset
select at runtime
Step 6: Input dataset
select at runtime
Step 7: FastQC
Output dataset 'output' from step 1
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 8: Cutadapt
Paired-end
Output dataset 'output' from step 1
Output dataset 'output' from step 2
Read 1 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R1
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Read 2 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R2
CTGTCTCTTATACACATCTGACGCTGCCGACGA
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Adapter Options:
0.1
False
1
3
In the adapters but not in the reads
False
False
Filter Options:
False
False
20
0
Not available.
any
Read Modification Options:
20
0
False
Empty.
Empty.
Empty.
0
Empty.
Output Options:
True
False
False
False
False
False
False
False
Step 9: FastQC
Output dataset 'output' from step 2
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 10: FastQC
Output dataset 'output' from step 3
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 11: Cutadapt
Paired-end
Output dataset 'output' from step 3
Output dataset 'output' from step 4
Read 1 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R1
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Read 2 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R2
CTGTCTCTTATACACATCTGACGCTGCCGACGA
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Adapter Options:
0.1
False
1
3
In the adapters but not in the reads
False
False
Filter Options:
False
False
20
0
Not available.
any
Read Modification Options:
20
0
False
Empty.
Empty.
Empty.
0
Empty.
Output Options:
True
False
False
False
False
False
False
False
Step 12: FastQC
Output dataset 'output' from step 4
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 13: bedtools SortBED
Output dataset 'output' from step 5
chromosome, then by start position (asc)
Step 14: bedtools SortBED
Output dataset 'output' from step 6
chromosome, then by start position (asc)
Step 15: FastQC
Output dataset 'out1' from step 8
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 16: Bowtie2
Paired-end
Output dataset 'out1' from step 8
Output dataset 'out2' from step 8
False
False
Yes
0
1000
--fr
False
False
True
False
False
Use a built-in genome index
hg38canon
Do not set
1: Default setting only
Very sensitive end-to-end (--very-sensitive)
No
True
Step 17: FastQC
Output dataset 'out2' from step 8
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 18: FastQC
Output dataset 'out1' from step 11
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 19: Bowtie2
Paired-end
Output dataset 'out1' from step 11
Output dataset 'out2' from step 11
False
False
Yes
0
1000
--fr
False
False
True
False
False
Use a built-in genome index
hg38canon
Do not set
1: Default setting only
Very sensitive end-to-end (--very-sensitive)
No
True
Step 20: FastQC
Output dataset 'out2' from step 11
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 21: Filter
Output dataset 'output' from step 16
Conditions
Condition 1
Filters
Filter 1
mapQuality
>=30
Filter 2
isProperPair
True
Filter 3
reference
!chrM
False
Step 22: Filter
Output dataset 'output' from step 19
Conditions
Condition 1
Filters
Filter 1
mapQuality
>=30
Filter 2
isProperPair
True
Filter 3
reference
!chrM
False
Step 23: MarkDuplicates
Output dataset 'out_file1' from step 21
Comments
True
True
SUM_OF_BASE_QUALITIES
Empty.
100
Empty.
Lenient
Step 24: MarkDuplicates
Output dataset 'out_file1' from step 22
Comments
True
True
SUM_OF_BASE_QUALITIES
Empty.
100
Empty.
Lenient
Step 25: CollectInsertSizeMetrics
Output dataset 'outFile' from step 23
Local cache
hg38
10.0
Not available.
0.05
True
All reads
Lenient
Step 26: Samtools sort
Output dataset 'outFile' from step 23
name (-n)
Step 27: Samtools sort
Output dataset 'outFile' from step 24
name (-n)
Step 28: CollectInsertSizeMetrics
Output dataset 'outFile' from step 24
Local cache
hg38
10.0
Not available.
0.05
True
All reads
Lenient
Step 29: bedtools BAM to BED
Output dataset 'output1' from step 26
Create a 6-column BED file
False
False
Empty.
Step 30: Genrich
Yes
Output dataset 'output1' from step 26
Yes
Yes
Output dataset 'output1' from step 27
No
Filter Options:
True
Empty.
0
0.0
False
Not available.
False
ATAC Options:
True
100
Peakcalling Options:
0.05
Not available.
20.0
0
100
Other Options:
False
Output Options:
False
True
False
Step 31: bedtools BAM to BED
Output dataset 'output1' from step 27
Create a 6-column BED file
False
False
Empty.
Step 32: Text reformatting
Output dataset 'out_bedgraph2' from step 30
NR>=3 {print $1,$2,$3,$4}
Step 33: MACS2 callpeak
No
Output dataset 'output' from step 29
Yes
No
Output dataset 'output' from step 31
Single-end BED
H. sapiens (2.7e9)
Do not build the shifting model (--nomodel)
100
-50
q-value
0.05
Peaks as tabular file (compatible wih MultiQC) Peak summits Scores in bedGraph files (--bdg)
Advanced Options:
False
False
False
Not available.
Not available.
Not available.
No broad regions
False
all
Step 34: Wig/BedGraph-to-bigWig
Output dataset 'outfile' from step 32
Default
Step 35: Wig/BedGraph-to-bigWig
Output dataset 'output_treat_pileup' from step 33
Default
Step 36: computeMatrix
Select regions
Select regions 1
Output dataset 'output' from step 5
No
Output dataset 'out_file1' from step 34
reference-point
beginning of region (e.g. TSS)
False
1000
1000
no
yes
50
maintain the same ordering as the input files
mean
mean
True
False
Not available.
Not available.
Not available.
ATAC-Seq
False
transcript
exon
transcript_id
select at runtime
Step 37: pyGenomeTracks
chr22:37,193,000-37,252,000
Configure figure parameters:
Empty.
12
72
0.05
left
Include tracks in your plots
Include tracks in your plot 1
Bigwig track
Coverage from Genrich (extended +/-50bp)
Output dataset 'out_file1' from step 34
#c0504d
1.0
No
0.0
Not available.
5.0
Configure bigwig parameters:
mean=mean value
Not available.
False
fill
True
False
No
Not available.
Include tracks in your plot 2
NarrowPeak track
Peaks from Genrich (extended +/-50bp)
Output dataset 'outfile' from step 30
#c0504d
1.5
box: Draw a box
True
1.0
False
Not available.
No
False
Not available.
Include tracks in your plot 3
Bigwig track
Coverage from macs2 (extended +/-50bp)
Output dataset 'out_file1' from step 35
#00b050
1.0
No
0.0
Not available.
5.0
Configure bigwig parameters:
mean=mean value
Not available.
False
fill
True
False
No
Not available.
Include tracks in your plot 4
NarrowPeak track
Peaks from macs2 (extended +/-50bp)
Output dataset 'output_narrowpeaks' from step 33
#00b050
1.5
box: Draw a box
True
1.0
False
Not available.
No
False
Not available.
Include tracks in your plot 5
Gene track / Bed track
Genes
Output dataset 'output' from step 13
manually
#000000
manually
#000000
5.0
yes
True
True
stacked (no overlap even with the label)
Not available.
flybase (blocks with arrow at extremities)
False
Configure other bed parameters:
1.0
manually
#808080
False
Not available.
60
0.5
When using gtf as input:
transcript_name
False
No
False
Not available.
Include tracks in your plot 6
NarrowPeak track
CTCF peaks
Output dataset 'output' from step 14
#00b0f0
1.5
box: Draw a box
True
1.0
False
Not available.
No
False
Not available.
Include tracks in your plot 7
X-axis
Empty.
Not available.
below
Not available.
png
Step 38: plotHeatmap
Output dataset 'outFileName' from step 36
no
no