ATAC-seq GTM with control

Annotation:

StepAnnotation
Step 1: Input dataset collection
select at runtime
Step 2: Input dataset collection
select at runtime
Step 3: Input dataset collection
select at runtime
Step 4: Input dataset collection
select at runtime
Step 5: Input dataset
select at runtime
Step 6: Input dataset
select at runtime
Step 7: FastQC
Output dataset 'output' from step 1
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 8: Cutadapt
Paired-end
Output dataset 'output' from step 1
Output dataset 'output' from step 2
Read 1 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R1
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Read 2 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R2
CTGTCTCTTATACACATCTGACGCTGCCGACGA
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Adapter Options:
0.1
False
1
3
In the adapters but not in the reads
False
False
Filter Options:
False
False
20
0
Not available.
any
Read Modification Options:
20
0
False
Empty.
Empty.
Empty.
0
Empty.
Output Options:
True
False
False
False
False
False
False
False
Step 9: FastQC
Output dataset 'output' from step 2
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 10: FastQC
Output dataset 'output' from step 3
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 11: Cutadapt
Paired-end
Output dataset 'output' from step 3
Output dataset 'output' from step 4
Read 1 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R1
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Read 2 Options:
3' (End) Adapters
3' (End) Adapters 1
Enter custom sequence
Nextera R2
CTGTCTCTTATACACATCTGACGCTGCCGACGA
5' (Front) Adapters
5' or 3' (Anywhere) Adapters
0
Adapter Options:
0.1
False
1
3
In the adapters but not in the reads
False
False
Filter Options:
False
False
20
0
Not available.
any
Read Modification Options:
20
0
False
Empty.
Empty.
Empty.
0
Empty.
Output Options:
True
False
False
False
False
False
False
False
Step 12: FastQC
Output dataset 'output' from step 4
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 13: bedtools SortBED
Output dataset 'output' from step 5
chromosome, then by start position (asc)
Step 14: bedtools SortBED
Output dataset 'output' from step 6
chromosome, then by start position (asc)
Step 15: FastQC
Output dataset 'out1' from step 8
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 16: Bowtie2
Paired-end
Output dataset 'out1' from step 8
Output dataset 'out2' from step 8
False
False
Yes
0
1000
--fr
False
False
True
False
False
Use a built-in genome index
hg38
Do not set
1: Default setting only
Very sensitive end-to-end (--very-sensitive)
No
True
Step 17: FastQC
Output dataset 'out2' from step 8
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 18: FastQC
Output dataset 'out1' from step 11
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 19: Bowtie2
Paired-end
Output dataset 'out1' from step 11
Output dataset 'out2' from step 11
False
False
Yes
0
1000
--fr
False
False
True
False
False
Use a built-in genome index
hg38
Do not set
1: Default setting only
Very sensitive end-to-end (--very-sensitive)
No
True
Step 20: FastQC
Output dataset 'out2' from step 11
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 21: Filter
Output dataset 'output' from step 16
Conditions
Condition 1
Filters
Filter 1
mapQuality
>=30
Filter 2
isProperPair
True
Filter 3
reference
!chrM
False
We keep properly paired reads, not on chrM, with MAPQ>=30.
Step 22: Filter
Output dataset 'output' from step 19
Conditions
Condition 1
Filters
Filter 1
mapQuality
>=30
Filter 2
isProperPair
True
Filter 3
reference
!chrM
False
We keep properly paired reads, not on chrM, with MAPQ>=30.
Step 23: MarkDuplicates
Output dataset 'out_file1' from step 21
Comments
True
True
SUM_OF_BASE_QUALITIES
Empty.
100
Empty.
Lenient
Step 24: MarkDuplicates
Output dataset 'out_file1' from step 22
Comments
True
True
SUM_OF_BASE_QUALITIES
Empty.
100
Empty.
Lenient
Step 25: CollectInsertSizeMetrics
Output dataset 'outFile' from step 23
Local cache
hg38
10.0
Not available.
0.05
True
All reads
Lenient
Step 26: Samtools sort
Output dataset 'outFile' from step 23
name (-n)
Step 27: Samtools sort
Output dataset 'outFile' from step 24
name (-n)
Step 28: CollectInsertSizeMetrics
Output dataset 'outFile' from step 24
Local cache
hg38
10.0
Not available.
0.05
True
All reads
Lenient
Step 29: Genrich
Yes
Output dataset 'output1' from step 26
Yes
Yes
Output dataset 'output1' from step 27
No
Filter Options:
True
Empty.
0
0.0
False
Not available.
False
ATAC Options:
True
100
Peakcalling Options:
0.05
Not available.
20.0
0
100
Other Options:
False
Output Options:
False
True
False
Step 30: Text reformatting
Output dataset 'out_bedgraph2' from step 29
NR>=3 {print $1,$2,$3,$4}
Step 31: Cut
c1,c2,c3
Tab
Output dataset 'outfile' from step 29
Step 32: Wig/BedGraph-to-bigWig
Output dataset 'outfile' from step 30
Default
Step 33: bedtools SortBED
Output dataset 'out_file1' from step 31
chromosome, then by start position (asc)
Step 34: computeMatrix
Select regions
Select regions 1
Output dataset 'output' from step 5
No
Output dataset 'out_file1' from step 32
reference-point
beginning of region (e.g. TSS)
False
1000
1000
no
yes
50
maintain the same ordering as the input files
mean
mean
True
False
Not available.
Not available.
Not available.
ATAC-Seq
False
transcript
exon
transcript_id
select at runtime
Step 35: pyGenomeTracks
chr22:21,620,000-21,660,000
Include tracks in your plots
Include tracks in your plot 1
Bigwig track
Coverage from macs2 (extended +/-100bp)
Output dataset 'out_file1' from step 32
#c0504d
0.0
40.0
5.0
Not available.
False
fill
True
Not available.
Include tracks in your plot 2
Gene track / Bed track
Peaks from macs2 (extended +/-50)
Output dataset 'output' from step 33
#c0504d
1.5
False
Nothing selected.
False
Not available.
Not available.
Not available.
Include tracks in your plot 3
Gene track / Bed track
Genes
Output dataset 'output' from step 13
#000000
1.5
True
genes
False
Not available.
Not available.
Not available.
Include tracks in your plot 4
Gene track / Bed track
CTCF peaks
Output dataset 'output' from step 14
#4bacc6
1.5
False
Nothing selected.
False
Not available.
Not available.
Not available.
Yes
Not available.
Bottom
png
Step 36: plotHeatmap
Output dataset 'outFileName' from step 34
no
no