Basic Statistics

Measure	Value
Filename	SRR8836584__fastq-dump__uncompressed
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	14394884
Filtered Sequences	0
Sequence length	126
%GC	35

Per base sequence quality

Per sequence quality scores

Per base sequence content

Per base GC content

Per sequence GC content

Per base N content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences

Sequence	Count	Percentage	Possible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT	73693	0.5119388249325246	TruSeq Adapter, Index 7 (97% over 37bp)
GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT	60466	0.4200520129234804	Illumina Single End PCR Primer 1 (96% over 32bp)

Kmer Content

Sequence	Count	Obs/Exp Overall	Obs/Exp Max	Max Obs/Exp Position
GAAGA	3974220	2.111342	12.467978	6
GGAAG	1896585	1.8772246	21.358154	5
CGCCG	451880	1.574039	6.354757	55-59
CGGAA	1565040	1.556183	21.11171	4
GAGCG	839960	1.5560771	19.651642	9
AAGAG	2868595	1.523968	11.824492	7
AGAGC	1483655	1.4752586	20.860527	8
GAGCA	1407375	1.3994104	11.113014	9
ATCGG	1234550	1.2411278	20.972294	2
TCGGA	1092695	1.0985171	20.970297	3
GATCG	967100	0.97225285	20.959332	1

Files created by FastQC

SRR8836584__fastq-dump__uncompressed_fastqc.zip (173.3 KB)

duplication_levels.png (17.6 KB)

fastqc_data.txt (8.9 KB)

fastqc_report.html (8.1 KB)

kmer_profiles.png (70.5 KB)

per_base_gc_content.png (10.8 KB)

per_base_n_content.png (8.3 KB)

per_base_quality.png (9.8 KB)

per_base_sequence_content.png (18.9 KB)

per_sequence_gc_content.png (25.2 KB)

per_sequence_quality.png (14.4 KB)

rgFastQCGW2HPd.log (1.6 KB)

sequence_length_distribution.png (18.7 KB)

summary.txt (718 B)

FastQC documentation and full attribution is here

---

FastQC was run by Galaxy using the rgenetics rgFastQC wrapper - see http://bitbucket.org/rgenetics for details and licensing